EST details — SGN-E539735

Search information 
Request: 539735Match: SGN-E539735
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190147Clone name: TUS-59-K9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77676 [cLES-2-O22] Trace: SGN-T97157 EST: SGN-E281997 Direction: 5' Facility: TIGR
Clone: SGN-C190147 [TUS-59-K9] Trace: SGN-T349144 EST: SGN-E548269 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539735Length: 437 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E539735 [] (trimmed) GTTTTTCAACATTGGGCTTGGTCCTGTTACTTGGGTATATACCGCTGAGATTTTCCCTCTTAAGTTTAGGGGTTTAGGAGTTGGAATTGGTGTCG
CGGTTAACAGGTTGATGAATGCAACAGTTTCTATGAGTTTTCTGTCAATTTCTGCAGCAATTACGACTGGTGGTGCTTTCTTCATGTTTGCTGGG
ATATCAGTCATCGCTTTGATCTTTTTCTACTTTTTCTTGCCTGAGACTAAAGGAAAGTCTTTGGAAGAAATGGAAGCTCTTTTCACTAGAGGAGG
CACATGTTCTAACCATGTTAGCAAACAAGTGGAGATTGCAAAATATTGATTCTTGATCAACTTTTGTGTAGAAAAATATGCCCTTTTTACTGTTG
AGATAAATTTTTGTAATCAATCCAGTTATGTATTATTAGTTATAAACATTAAATTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539735] SGN-U585381 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340610 [Download][View] Facility Assigned ID: TUS59K09_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5