Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E539761

Search information 
Request: 539761Match: SGN-E539761
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190162Clone name: TUS-59-K24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77802 [cLES-3-F2] Trace: SGN-T97809 EST: SGN-E284788 Direction: 5' Facility: TIGR
Clone: SGN-C190162 [TUS-59-K24] Trace: SGN-T349148 EST: SGN-E548273 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539761Length: 661 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E539761 [] (trimmed) TACGTCAGAAACTAGGAGTCTTGACAAACAGGTGGAGTTTCAAGTCATTCAGAACGAGAGCGATTTAAAGGAACCTGAAGAGGAGGATCAAGAGC
CACAGACTGAAACTGATATTCCAGAATCTATGCCATCAGATATCCATCAGAGTATAGCTCAAGATCGGCCAAGGAGGGTTGGAGTTCGGCCACCT
ACGAGGTATGGTTTTGAGGACATGGTGGGTTATGCACTGCAGGTTGCTGAAGAGGTAGATACATCTGAGCCGTCTACTTACAAAGAAGCCATTTT
AAGTTCTGATTCTGAAAAATGGTTTGCCGCTATGGGAGATGAGATGGAGTCCCTACACAAGAATCAGACATGGGATCTGGTCATACAGCCTTCGG
GGAGAAAGATTATTACTTGCAAATGGGTTTTCAAGAAGAAGGAAGGGATATCACCAGCAGAAGGAGTCAAGTATAAAGTCAGGGTTGTTGCTAGA
GGTTTCAACCAAAGAGAGGGAGTGGACTACAATGAGATCTTCTCACCAGTGGTCAGACATACTTCCATCCGAGTGTTACTAGCGATAGTTGCACA
TCAGAATCTGGAGCTTGAAACACTTGATGTGAAGACAGCGTTTCTACATGGAGAGTTGGAGGAAGAGATATACATGACTCAGCCGGATGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539761] SGN-U575023 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340636 [Download][View] Facility Assigned ID: TUS59K24_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5