EST details — SGN-E539800

Search information 
Request: 539800Match: SGN-E539800
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190186Clone name: TUS-59-L24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77913 [cLES-3-L16] Trace: SGN-T97594 EST: SGN-E284573 Direction: 5' Facility: TIGR
Clone: SGN-C190186 [TUS-59-L24] Trace: SGN-T340677 EST: SGN-E539802 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539800Length: 815 bp (892 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539800 [] (trimmed) ACCTAATCAAACAGCAATTACATATATTCGACCATTGTATTACACAGCCATTACAAAAAGCCCTAAGGAAACACAAAATGCTTTCAACATGATAT
TCATAACCACACTGACATGAGAAGTAAAAAAAACTAGATAAAACTCCGCCTGCATCCAGGATCAACCCACAATAACAAATCTGCATCACTTTAAG
CCTTGTTAGCAATGTTGTTAGAAAGCCAATCAAGTCCCTCATAAAGCCCCTCGCCAGAAGTTGCACAAGTGCTCTGGATGTACCAGTGACGCTGC
CTGAGGGAGTGCAGTCCAAGCTTATCAGTTATTTCAGCAGCATTCATTGCGTTAGGAAGATCTTGTTTGTTAGCAAATACTAGAAGCACAGCATC
CCGAAGTTCATCCTCGTTCAACATCCTATGCAATTCATCTCTTGCTTCTACAACACGGTCTCTATCATTGCTATCAACCACAAAAATGAGACCCT
GAGTGTTCTGGAAGTAGTGCCTCCACAATGGACGGATCTTGTCCTGACCTCCGACATCCCAAACAGTGAAGCTGATGTTCTTGTACTCAACAGTC
TCCACATTGAAACCAATGGTAGGAATAGTAGTCACGATCTCTCCCAGCTTCAACTTGTACAATATGGTGGTCTTACCAGCTGCATCAAGACCAAC
CATTAGAATGCGCATTTCCTTCTTGGCGAAAAGCCGACTGAAGAGCTTGGTGAATGTGAGCCCCATCACGCTTCCTTGATGATGATCCCTGAAAA
GAGCTTTTAGAATGAGGGATCTATTGAGGTCTCCAGTTTTTTTTTTTTTTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539800] SGN-U580248 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340675 [Download][View] Facility Assigned ID: TUS59L24_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5