EST details — SGN-E539885

Search information 
Request: 539885Match: SGN-E539885
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190236Clone name: TUS-59-O2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78881 [cLES-7-B13] Trace: SGN-T98910 EST: SGN-E288154 Direction: 5' Facility: TIGR
Clone: SGN-C190236 [TUS-59-O2] Trace: SGN-T340763 EST: SGN-E539888 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539885Length: 789 bp (834 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539885 [] (trimmed) CCAGATCAACTGCACAAGGACTAAAACAATCCGCAAAATTCGCGATTGATGAAGCATAAATGAAAACTTTGGACATCTGATGCAAAACATTCAGA
CAAACATCTTGCAATACTATCTGGGGTTTGTGTAGACCCTGTATCTATGTTTTAAGAGATGAAACCTAATCCTTTACCTTTGTAGCATTTTCTAA
TTATCTACCCAACAACTCCTCCAACTTTGTCATCCATGATACAACCTGCAAGCAAGGATACCACCTAATTAGACTCCCTGTTCCGCTGCCCACGA
GACTCGGATCATCCCTGGCTAGATGATGCTCCAAAGCTTCCCAAAGGCCATGGCAATGATATTGTAGTAAACCTTCTCCCTGATCCCCCACTTCC
AGAAGCAGAACCATCCCCGCTCGAGTCCCCATCATTGTCTCTTTGCCTGTTCTCATTCTCAGGCTCATCCGTTGGCAACTCATAGCGACAAACCG
GGCAAGAACTGTGCAACTCAAGCCACGGTATGATACAATCCTTATGATAAACATGCTTACAAGGCATCTGTATCACATCTGACCCCATCTCAAAA
TCATCCTTACAAACAGCACACTGTGCCAGTTCAGAACGCATCAATTCCTCATCAACTTTGATGGTAGGGAGCCCCTCCACCGCTGCTCTCGACGC
CGGAGGAGTCCCATATCGGTTTGGATCATTTTCTGCCAAATTCTGGATCAATTGCTCAAACCCCGGTCCAATGAAATAGTCCCCATAATTCGCCG
GCATTTGGAGACCACTACCCCCGTTACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539885] SGN-U569746 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340760 [Download][View] Facility Assigned ID: TUS59O02_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5