EST details — SGN-E539944

Search information 
Request: 539944Match: SGN-E539944
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190270Clone name: TUS-59-P12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C79135 [cLES-7-O17] Trace: SGN-T98715 EST: SGN-E287959 Direction: 5' Facility: TIGR
Clone: SGN-C190270 [TUS-59-P12] Trace: SGN-T349179 EST: SGN-E548304 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539944Length: 435 bp (974 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E539944 [] (trimmed) GGCCAAAAAAAATAATTTATATAATGATAAAATAAAATAATTTATTCTATTCAATCCCTTAAAACATAATTACATGAGATGATTTATAATAAGCG
AAACTCGTAACTTAAAAATACTACAAACATTATTTTATAACAAATAATTAATTTAGTAAACTCGTAATATAAAACTTCTTTTTATCGTCAGTGCA
TATATGATTAAGGGCATTTTGGGCCTCCTCTCTTAGTCTTCCAATTATTGTAACAAGGGCAAAATTGTTTGTTCCCATAAGTCCCAGCAGGAACA
CAGAAACTCTTTGCACAACATTTTTGGCAAAAAAAAATACATGGCTTCCTATATTGGGGATTTGAGCATCTATATGGGCACTTTGGTAAACAATC
TTGAGGATGGAAACTACCAGGAGTAGTACCATTTATTGGTAAAATGTTTGAAGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539944] SGN-U582359 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340819 [Download][View] Facility Assigned ID: TUS59P12_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0244 Quality Trim Threshold: 12.5