Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E540025

Search information 
Request: 540025Match: SGN-E540025
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190316Clone name: TUS-60-B10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C79457 [cLES-9-A20] Trace: SGN-T99301 EST: SGN-E287482 Direction: 5' Facility: TIGR
Clone: SGN-C190316 [TUS-60-B10] Trace: SGN-T340898 EST: SGN-E540023 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540025Length: 728 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E540025 [] (trimmed) GAAAATGAGGTTCATTGCCCTTGTGTTCTTGGTTGGTGCTTTGGCCATTATAGCTGTTGATTGCAACTCTGAATGAGATGCTCTTAATGCATTCA
AAACTAATGTGGCAGACCCAAACGATGTGCTTCAAAGTTGGGACCCGACTTTAGTCAACCCTTGCACATGGTTCCATGTCACTTGCAACTCCCAA
AATAGTGTTGTGAGAGTGGACCTAGGTGATGCTAATCTCTCTGGATCCTTGGTACCTCAATTAGGAATGCTAAGCAATCTCCAATACTTGCTAAT
CCAAAATAATTCAATTAGTGGAGAAATTCCGAGTGAATTAGGGAACCTCACAAAGTTAGTAAGCTTGGGGTTAGAAAATAACAAGCTCAGTGGTT
TTATTCCATCGTCTCTTGGCTATTTAAAATTACTACGATATATGAGATTGAATAGTAATAAATTATCAGGGGAGATTCCTATTTCTGTCTTGAAG
CTCGTCTTGTGGGGCAATTTTAAGCTTATGAATGTTTCAGACAATAAACTGGCGAGAACTGTCCATCATACTAATATCACAGGATTTGCAATTAC
AACAATTGTTCTAGACGTCAAGGACATATAGCATTCTCCAGACAAGTTGCAGTAATTCTATATATTAATTGAGTCATTAATGTATCAAGTCTAAG
TCTAGATTTAGGAGGTTTGTGATTCTGAATAATTAATCTTAGAATGTGATTGAAATATATGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540025] SGN-U569924 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340900 [Download][View] Facility Assigned ID: TUS60B10_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0261 Quality Trim Threshold: 12.5