EST details — SGN-E540218

Search information 
Request: 540218Match: SGN-E540218
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190428Clone name: TUS-60-G2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U582445 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C75198 [cLES-13-D2] Trace: SGN-T100302 EST: SGN-E285989 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540218Length: 423 bp (950 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E540218 [] (trimmed) GAAGCCCTCCTCTATAGTTTCCATTCTCTCTTTTTCCCTCTTCTTTCTCTCTCAAATCTCTCCATCTCTTTCAGCTGAAAGATGTCACCCAAATG
ACAAAAAAGCCCTCCTAGAATTCAAAAAAGCTCTAGGTAATCCTGATGATTTGGGTAATTGGAATCCCAAAACTGATTGCTGCATTGGCTGGGAC
GGACCTACTCTCGAATGCGATGAAAAATCGAATCGGATTAATCTCATCGATTTCTCCAAAATGAATCTCTCTGGATATCTCTCTCCCGCCATCGG
AGATCTCACATACCTTACGAAATTCAGTATCCACAATGTACGGAATCTCACCGGTCCAATTCCATCGACAATTGTTAAGCTCACGAATCTCATTT
TCTTCAGAAGTAGTGAATCAGACATTTCAGGACCAGTACCTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540218] SGN-U582445 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341093 [Download][View] Facility Assigned ID: TUS60G02_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0114 Quality Trim Threshold: 14.5