EST details — SGN-E540263

Search information 
Request: 540263Match: SGN-E540263
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190456Clone name: TUS-60-H6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C75339 [cLES-13-L12] Trace: SGN-T100475 EST: SGN-E286162 Direction: 5' Facility: TIGR
Clone: SGN-C190456 [TUS-60-H6] Trace: SGN-T341141 EST: SGN-E540266 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540263Length: 775 bp (899 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540263 [] (trimmed) ATAAAATAAATGTACAATATTTATCTTACACAGGAACAAAGTATAATGCGCCTTGTAATTTTGACCAACCGAAATCAACATAATAGAGATATTGG
ATTTAACTACTTCCTAATTCTACTGGCAACTTATTTCAGTATCAAAATGGAAATAAAGTGATTCAATTTAGAAATTTGAACACTGAAATGCTACA
ATTTGGGGGATGAAATAAGTTATGAAAGCCTTTTGGCCTCACTGACATTTTCAGACAGGAAACCGGGAAACTTACCAGAAATCAAATTATACCTT
CACGCTAAACCATTATTAGCATACAAGGACATCAATGTTAACTATAAAAACAAAAAGGAACCATGAAAGCAATACAGATGATTGATTAAAGTATC
CCTACCGAAAAAATAATGCAATTTGACACAGTTTGCAAACAGGCAACAAAATGCTGATACATAAAAGGCGTAACAGTGCAATTTGACACAGTATG
CAAACGGGCAACAAAAGGCTGATACATAAAAGGCGTTCCACATACCTGGGCTGGGAATGTTGAAGGATAAGCACCATAACCACCACTGGAGGGCA
CTGATGCTGCAGGCGCTTGAGGAGGTGCATAGCCAGTTCCATAACTGCCGTAAGCACCATATGCCGCCTGTTGTGCATAACCAGGATTCCACTGC
TGCGATTGGGCTTGTGCAGCCTGTGGCCAGGTTTGACCTTGTGCACCATAACCTGCAGGCCATTGATTCTGTGCTCCAGGATATGCACCAACCGC
TGAAGGGTTGGTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540263] SGN-U577631 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341138 [Download][View] Facility Assigned ID: TUS60H06_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0021 Quality Trim Threshold: 20.5