EST details — SGN-E540320

Search information 
Request: 540320Match: SGN-E540320
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190489Clone name: TUS-60-I15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C75593 [cLES-14-L17] Trace: SGN-T100672 EST: SGN-E286851 Direction: 5' Facility: TIGR
Clone: SGN-C190489 [TUS-60-I15] Trace: SGN-T349241 EST: SGN-E548366 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540320Length: 777 bp (904 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540320 [] (trimmed) ANTAAAGAAACAAATATCATTAATATAGTTCTTGTAAACTTGATTGAAATTCGAATTAATCATACACGGAATAAAAAGATGGAAAACAAGGGAAA
ATGAATACAATTTCTCAAGGGAAAACCCAAAGGAGAATTCAAACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTCTAGAACTTAGTATCC
TTCGGGCTTGTAAGCGATGAAACTGATGCACTGCACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGTGGGTAAGCCTTCTTTG
CCTCCTGCACCTCAGCCAAGACCTGGGTTGCATCAGTGCACCCGAACATGGGCAACTTCCACATGGTCCAGTATCTGCCATCGTAGTATCCTGGT
GACTTATGGTTCTCACGGTACACAAATCCGTGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTTTCAATAGGTACTCAATTTCGCTGAG
CAATTGCTCGTCGGACAAATCAGGAAGGTACGACAGAGTCTCGTACTTCTTCATGTTAATTGGTGGCCACACCTGCATGCAACTGACTCTTCCAC
CGTTGCTAGCAATGGAGGTAATGTCAAGGTTTTGCTTCCTTGAAACAGGGAAAGAAGCGGTGGACTTGAGTCCAGTGAAGGGTGCAACCATGCTA
GCTTGTGCACCATTGCCGCGGGTGGCAACAGCTGCTGAGGACATTACTGAAAGAGCCATTGCTGAAAACCAAGTGCTTATCTTTTTTTTTTTTGC
TAAAACACCTCTAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540320] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341195 [Download][View] Facility Assigned ID: TUS60I15_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0042 Quality Trim Threshold: 20.5