EST details — SGN-E540390

Search information 
Request: 540390Match: SGN-E540390
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190528Clone name: TUS-60-K6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C75965 [cLES-16-F16] Trace: SGN-T101047 EST: SGN-E288321 Direction: 5' Facility: TIGR
Clone: SGN-C190528 [TUS-60-K6] Trace: SGN-T341262 EST: SGN-E540387 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540390Length: 649 bp (848 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E540390 [] (trimmed) CAACCAAAACATAATATTTTTTTTCAAAAGTGGAATAAAGAAAAATAATTAACATTAAATAGGAGTTACCACTCATTTATTGGACTACTAGCTGC
ATGGGGACCCACTTATTGTACTGCACACTTATCCTTTATCTTATAAATTTACGTTCACAGCACGATAATATAATTCGTGAAAAAAAATAGGGGGT
ATGTAGATTTATACGTTTCGTTTATGAAACGTTTTAAATCCTACTGGAAGTTACTTTCCAACGGAATTCATCTGCTTCTTCATCTCTAACGAAAG
TATAGGCCTTTAAATTTCCATCAATTTCAAGTCTAAAATATGTCAATGTTGGGTTGTATTTAGAAAATGCCATCACATGTGAACTTCTTTGGGTT
GATTTTGCAAATCTATAATCCAATTTCAATCTTTGATTCCCACTATTTAATTTTATCGATTCCAATGTGTTATTTCCATAATCGAACCAAGCTAA
TTCCACGTCAACCTTGTTTCCCTTGTAGACTGCAAACAATCTCGGCTGCACCACCAAGCTATAAGGCCCGTTCGCATTCTTTTTCACCGAGGCCC
GGCTCACAAGCTTATTCGGGCCGGACAATCTGAGAGTTTGGCCCACTAGTAAAGTGTCAGTGGGATAGTTGAAACTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540390] SGN-U569601 Tomato 200607 Build 2 89 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341265 [Download][View] Facility Assigned ID: TUS60K06_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5