Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E540407

Search information 
Request: 540407Match: SGN-E540407
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190538Clone name: TUS-60-K16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76031 [cLES-16-J21] Trace: SGN-T101012 EST: SGN-E288286 Direction: 5' Facility: TIGR
Clone: SGN-C190538 [TUS-60-K16] Trace: SGN-T341279 EST: SGN-E540404 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540407Length: 658 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E540407 [] (trimmed) AGAGAGGGCAAAAATATACACTCCATTAAATTTTTGGTATATTTAAACAGAAAAATATCATCAAAATACATTGTAAAATGTAGAAGATAATATAA
GTAAATTAATCTGTCAGCCTCCTTTTCTACCTGCCATTTTTATTCACGGAGAGCTGACCGGAAAGATTATGCCTAAACCTTTTACAACGACGGGA
ACTAGGCGCTATACACAGTTAACTATATGAAATATTACAAGAAACAACTTAAAATAGTTTTTGTATACCCTAACTATATAGTTTCCTACCCTCAA
TCTAACTGCAAACTATTACATTCATAATTCATTCATTATTTTTGGCTCTATGAACGTTTTCACAACATTGGAATACATCATCGTACTCACAATTG
TTGTGTGTATTCATTTGGTTCGTCTTCCCCCTCCTCATCCATCTTAATTGAAAGCAGCTGCCACTTGCCTTCACCATCAATCAACCGTAATTCCA
CAGAATGGAAAGGTATTAAAGCAGGGCGCTGTGAGGATGTAACAACAGTAATGCCAGCATCCTTAGCAAGCCTATACAGGTGTTCTTCAACATCA
ACACTAGTAGCATTTGTACATTCGTCAAGGATTCCAAACCGTGGCTTGTGAAAAAATAAGCGTGCCATTCCTAATCGTTGTTGTTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540407] SGN-U565869 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341282 [Download][View] Facility Assigned ID: TUS60K16_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5