Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E540469

Search information 
Request: 540469Match: SGN-E540469
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190576Clone name: TUS-60-M6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76268 [cLES-17-H22] Trace: SGN-T101312 EST: SGN-E288870 Direction: 5' Facility: TIGR
Clone: SGN-C190576 [TUS-60-M6] Trace: SGN-T341347 EST: SGN-E540472 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540469Length: 745 bp (899 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540469 [] (trimmed) TAATTATTTTCCTTACGTACATATATTTCAATCATATTTTAATATTAATTATTCAGAATCACAAATATCCTAAATCTTGACTTTGACTTGATACA
TTAATTAATTAATTAATATATAGAATTACTGCAACTTGTCTGGAGAATGCTATATTTCCTTGACGTCTTGAACAATTGTTGTAATTGCAAATCCT
GTTTTATTAGTATGATGGACAGTCCCTGCCAGTTTATTGTCTGAAACATTCATAAGCTTCAAATTGCCCCACAAGACGAGCTTCAAGACAGAAAT
AGGAATCTCCCCTGATAATTTATTACTATTCAATCTCATATATCGTAGTAATTTTAAATAGCCAAGAGACGATGGAATAAAACCACTGAGCTTGT
TATTTTCTAACCCCAAGCTTACTAACTTTGTGAGGTTCCCTAATTCACTTGGAATTTCTCCACTAATTGAATTATTTTGGATTTGCAAGTATTGG
AGATTGCTTAGCATTCCTAATTGAGGTACCAAGGATCCAGAGAGATTAGCATCACCTAGGTCCACTCTCACAACACTATTTTGGGAGTTGCAAAT
GACATGGAACCATGTGCAAGGGTTGACTAAAGTTGGGTCCCAACTTTGAAGCACATTGTTTGGGTCTGCCACATTAGTTTTGAATGCATTAAGAG
CATCTCCTTCAGAGTTGCAATCAACAGCTATAATGGCCAAAGCACCAACCAAGAACACAAGGGCAATGAACCTCATTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540469] SGN-U569924 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341344 [Download][View] Facility Assigned ID: TUS60M06_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0016 Quality Trim Threshold: 12.5