EST details — SGN-E540538

Search information 
Request: 540538Match: SGN-E540538
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190616Clone name: TUS-60-N22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C84710 [cLET-2-A21] Trace: SGN-T102809 EST: SGN-E291268 Direction: 5' Facility: TIGR
Clone: SGN-C190616 [TUS-60-N22] Trace: SGN-T341416 EST: SGN-E540541 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540538Length: 883 bp (889 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540538 [] (trimmed) GGGTACGGGCCCCCCTCTGGCATTAAGTCGAGAATTGGTAGACCTCTTTTCCTCGACCACTGCTTGCCGATCACCAATGAGAACTGGAGAAGCCT
CGATTGCTTTTTGCACAGCACTTTCCACTTCAAATTCCACGAATCCAAAACAAAATCCCCTGTTACTTCTCACTTGAATTCCTCCATTTTTTATT
GGCCCAAACTTCTTGAACTCATCCGCAAGTAATGCCACAGTTGCACTCATAGGCAGGCCTTTTATATAGATTGAGTAGCCATCAGCTTCTGTGTC
ATTTATGTTATCAATGGTCTCTGAGCTGGAATATGGGCCATCAGTTGTTGTGGCAGCAGGCTGATTCACTTGCACAACACTCTTTGTCATAGGCT
TCCTAGCAGCAGGTGCTGGAGGAGGGGAGAAGGTTGCAGCACTTTCCTTGAGATGCATGACAATTGAAGCATATGACTTCTTAGGAACTTCCCCA
GTTTTGTTGTCAGATTCCGCTACCACTTCAGAGCCATCTTGGACTTCATGGACGACCTCAGACACAGGCACTTCCTCCTCAACAATAAGCACATC
ACCATTCTCAGATGGGTTGTAAACTTCTCCCACGTCAGCTTCCTCTGCTGGTGGAGTGCTTTGCTCAGGAATGTGATTCTGTGGTGCTGTAGGTG
GATCTGCAACAATTTGCTCTGGTGTGACAGGAGCCACAGCATCAGTTACTGGAACCTGGACTGTATCATGCTGACTGGCAGTCTCTACATATCGA
AACATATCATTCAAGACAAAGTACCCCCTATCTTGTGGTGCTAGGAAGAAAGTTTGACAGAAATTCCGGAACAAGTTGTCTTTCCCAGTCGAATA
TCCAGTTACAAGGACATGCACCCCGCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540538] SGN-U585096 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341413 [Download][View] Facility Assigned ID: TUS60N22_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0004 Quality Trim Threshold: 20.5