EST details — SGN-E540551

Search information 
Request: 540551Match: SGN-E540551
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190622Clone name: TUS-60-O4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C84763 [cLET-2-D17] Trace: SGN-T102891 EST: SGN-E291350 Direction: 5' Facility: TIGR
Clone: SGN-C190622 [TUS-60-O4] Trace: SGN-T349278 EST: SGN-E548403 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540551Length: 588 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E540551 [] (trimmed) AGCTATGGCGGACACCACAACAACAACAACAATCTCCGGTGACTCTATTACGGTTACCGATGACCAGAAAAACAATCCCACGAACCCACTTGCAT
CATTTATCTCTAGTGTTCTTCAGCTTTTCAAACCGCCGCCGGCATCTAGTAAGAAGATTGAACCCACCGCTGCTACTTCAGACCTCAAACCAATT
GCTTCAGCTGAAAAAGAGGAGAAAGCTGCTGTAGTGAAGTTTCCGCGACAGGATTTGCCTTCGTTGAAGCTCGAAACAGAAGGGGCTGAACCTAA
TACAAATCCCATTGTCTTGTGGCAGGTTTATGCTATCTGAGGGTTCTTTGTCTTAAGGTGGGCATGGTCAAGATGGAACGAGCGTCGTGGAAACA
GGAAGCCATCCGATGAAGAGCCTCCTCCCAGTCAAGAGTAGACTTTGTACTGCAACATGTTAGAAAAGAGAAAACAAAGAATGACACTTGTGGAG
ACAGGTTTATGACTTTATTTGAGTCTTGTAAAGTGTTGAAATCACAGTTCTGGTTTTACAGTACTAAATGTAAAAACCCGAATCAAGCTTTACGT
CAATTTGCCAGTCAGCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540551] SGN-U565853 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341426 [Download][View] Facility Assigned ID: TUS60O04_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5