EST details — SGN-E540612

Search information 
Request: 540612Match: SGN-E540612
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190659Clone name: TUS-60-P17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C87358 [cLET-4-D21] Trace: SGN-T103286 EST: SGN-E289615 Direction: 5' Facility: TIGR
Clone: SGN-C190659 [TUS-60-P17] Trace: SGN-T349289 EST: SGN-E548414 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540612Length: 807 bp (894 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540612 [] (trimmed) GGAGAAGTGAGAATTATATTACAATCAATATTGTCATGATTTACATTTAAGCGCAAACAAAATCAGAACAAAGATTAGAGACATCTCAAAGTAGA
GAACAGTTGCTTCATCCCCTTTTTTGGCACTTCCGCCAGATTTTGTACAACAGGTGTTTCAACATCAAGAAAGCCAGCAACAAACTACACTGCAA
CTTCTCCCTGTAGCATTTGCATTGTTTTGAGTATGAATAAAAGAGAACCTCTTCTAAATTACTCTGATATTTCATCATCGGGTTGTATTACAGTT
AGCAAGGAATATTTGACCCTCACAGAGATCCTTCCTTTCTCAACCATAAGCCTTGCACCTGAAACAACCCAATAACCAGGAGGTTCCTGTGGTCC
TCGAGTCATCTCAGTAGTATCGACAAATTTCAAGAGCTTAGGGGCTTGCACAGGAACTGGAGGACCACCAGGGTAAATGGCAGAATTTATGTTCA
CATCATCTGGCCGAGGAGGTGGCTTCTGAACTGATGTAAAGTGCTGGCTAATGAGAGTTGATATCAGGCCAGATTTGCGAGCCAACCCAGGGGAA
CCATCCCACTCAGCGTGCTTTACCATAGTAGCTCCCATGACAGTCGAGAAACGGAGTCTCAGAAAGAGGACCTTTTTAAACCCATAATCCCCTAA
TTCCAATTGTGCTCCAGTAACTATGTTAAGGTCTTCATCAGATTCAACAGGTGCGGTGCAAACGTGAGAAAAGTTCTTCCATTGAACTTTTTCAT
AGTATTTGCGATCATATGATTCTCGGCGAAAAGTGCCTTTTGGATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540612] SGN-U585158 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341487 [Download][View] Facility Assigned ID: TUS60P17_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5