EST details — SGN-E540641

Search information 
Request: 540641Match: SGN-E540641
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190676Clone name: TUS-61-A10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C87490 [cLET-4-N18] Trace: SGN-T103344 EST: SGN-E289673 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540641Length: 458 bp (872 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540641 [] (trimmed) CCGTGTATGATTAATTCAAATATCATTAATATAGTTCTTGTAAACTTGATTGAAATTCGAATTAATCATACACGGAATAAAAAGATGGAAAACAA
GGGAAAATGAATACAATTTCTCAAGGGAAAACCCAAAGGAGAATTCAAACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTCTAGAACTTA
GTATCCTTCGGGCTTGTAAGCGATGAAACTGATGCACTGCACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGTGGGTAAGCCT
TCTTTGCCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCGCGATCCCCCAGGGGAAGAGCGGATGCTAGAG
CGGTGGAGATCCAGCCCTTGTTCCCGTTATTGAGGGCTAAATTCCAGCTTGGCGGACAGATGGGCATATCGGTGGACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540641] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341516 [Download][View] Facility Assigned ID: TUS61A10_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0017 Quality Trim Threshold: 12.5