EST details — SGN-E540796

Search information 
Request: 540796Match: SGN-E540796
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190766Clone name: TUS-61-E4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C88465 [cLET-8-F13] Trace: SGN-T104518 EST: SGN-E291122 Direction: 5' Facility: TIGR
Clone: SGN-C190766 [TUS-61-E4] Trace: SGN-T349319 EST: SGN-E548444 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540796Length: 479 bp (831 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540796 [] (trimmed) AGAAGGAAATATACTCAAAATTTCATAAACTTAAATAAGTTGAGCAGTGACCAAGACTGTGTGTAAAGTGATTTAACCCAGGTAAAGGAACAACC
AACAGAGCTATATGTCATTGCCCATCAAGTAATTTGGTCCCGACATAATTGCTCAATTACTCCACTATCCTCAAAAAGAGGCTAGAGAACCATGA
CAATACCTTCTGTAGCCATATCTCACAAACATGGCAAAATGCTGTCCAAAACAAAAATGAAAAAAACTGATGCAAATAAACAAAACTATTTCATC
CGTGCTCATCAAATGCACTCTACTTTCCCTTCTTCTGGGCTTGGTGGGAATCATCTTAACCATACCGAGCATCTACCATTCTTCAAGAACTTAGG
CTCCTTCTCAAGTTCCTTACCTGAACGCCTGTCAATCTTGGTCAAGATCTCAGCAAACTTGACAGCAATGTGGGAAGTGTGGCAGTCAAGCACTG
GTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540796] SGN-U577204 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341671 [Download][View] Facility Assigned ID: TUS61E04_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5