EST details — SGN-E540871

Search information 
Request: 540871Match: SGN-E540871
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190810Clone name: TUS-61-F24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C88842 [cLET-9-N14] Trace: SGN-T104804 EST: SGN-E289989 Direction: 5' Facility: TIGR
Clone: SGN-C190810 [TUS-61-F24] Trace: SGN-T341749 EST: SGN-E540874 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540871Length: 406 bp (915 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540871 [] (trimmed) ATACTTAATATCTCCACTTTGTTTATTTTTCATAACATAATAATGTTCTTAACCCATAGAATAATTAATTAACCCATTCTGGGAGTAATTTTAAC
AATGGCCTCCCAATCAACAACCAGAAAAACTCTACCACAAACATAATTACCTGGCCTTGGCATACCAGGAAATAAAACACTAACATGAGCTATGG
GATTTTCCTTCTCAATTATTTTCTTAGCATATTCTGCTGGCTTCCCAACAAGTTCAGGCCATGATTGCTTACCTGAGCAAAATGCATCTTGTATT
TCATTTTCTAGAATTTCCAGCACTTCTATTCCATCACTCAAATCTCTTGCCATCAGTGATTGAAAAAGTGATGCAAGAAGCAAGAAAGCAAGAAC
ATGAGATAACTTGAGCATACTCTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540871] SGN-U584912 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341746 [Download][View] Facility Assigned ID: TUS61F24_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5