Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E540899

Search information 
Request: 540899Match: SGN-E540899
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190826Clone name: TUS-61-G16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U564497 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C79984 [cLET-10-O11] Trace: SGN-T104971 EST: SGN-E290802 Direction: 5' Facility: TIGR
Clone: SGN-C190826 [TUS-61-G16] Trace: SGN-T341776 EST: SGN-E540901 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E540899Length: 735 bp (915 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E540899 [] (trimmed) GCAGTTATCAACAGTGTTGTTATACTTGACAATAACAATTAAATAGTAGTAAATATAATTAACCTGTAGTATTTACTAACACATATATTACATCT
GCAGCAAAATTGTGTCCAAAATCAACCTAGTTTTACTTCTCTTTATCAACTTTCTTTCCAATCCAAGTAGCAACAATTGGTGTTAAAGCAACAGT
AGGGGGAAATCTAATAGGTGATGCGGCTTTGTGAGCGGCATAAGCCAATGCAAAAGTTCCCACTTTCTCACCAGTCTCATCAGTAGAAATACCAA
CCTTTTGTAGCAAGGATTGAACATCAACACCAGAATTGATGAGAGCATAACAGAGACCAAATGATATCAATGAGAGAGTAATTGAAGTTGCTAAA
TAAGCTCCTCCATATTTTGCCAAAAGCTCTTTTGCTTGATCCCCTTTTGATTTCTTATCCTTGTTCTCTTCATCTCTATCCTCTTTTGAGCTAAA
TATCTTCCATAGGCCAGCTTCTAAACCAAATTTCTTTGTAATTTCCTCAGCAGATTTAACTTCTTCTGTTGTTTTCTCCTTCAATGCTCTAATTT
TAAACTTTTTATTGGAATTTGAGGTAACTGAATTTAGTGCCTTGTTTGGTTTTCTTAAATTTGGAAAAACAGGAAATAAAGAACAAAGAGCAATT
TTACTGTACTGAGAAGAAATTTGTAAAGCAGAAGCCATATTTTTTTTGAGTTTATCCAAACGCGGCGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E540899] SGN-U564497 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341774 [Download][View] Facility Assigned ID: TUS61G16_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0040 Quality Trim Threshold: 12.5