EST details — SGN-E541015

Search information 
Request: 541015Match: SGN-E541015
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190892Clone name: TUS-61-J10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81307 [cLET-15-J4] Trace: SGN-T106572 EST: SGN-E293621 Direction: 5' Facility: TIGR
Clone: SGN-C190892 [TUS-61-J10] Trace: SGN-T341887 EST: SGN-E541012 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541015Length: 777 bp (896 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E541015 [] (trimmed) GATTGAATTCTCTTTGTATTCCCTAATCCCAACCCAAAAATGGCTCTGACAGCAGCCACCGCCGGCGGCAACAGGGGTGGCTCAGCCCTCCCCAA
TTCGTGCCTTCAAGCCCCAAAACCTGCACCGTTGCAGAAACCCATCTTCTTCTCTTCCTTTCCCAAAATAACAATCCCGTCAAACTCCAAAATCA
AACCAAGAATCAAACCCATCTCAGCCGTTCAATCTCCACCCTCAACAACAGCAAAAACTGCTCAAAACCCAGAAGGAAAATGGAGTCTCGAAAGC
TGGAAATCGAAGCCGGCTTCTCAGCTCCCTGAATACCCTGATAAGGTAAAGCTGGAATCAGTTCTCGAGACCCTTTCGACGTATCCCCCAATTGT
ATTTGCTGGGGAAGCTCGGAATCTTGAAGAGAAATTGGGCGAAGCTGCTCTTGGGAATGCTTTCTTGTTGCAGGGTGGTGATTGTGCTGAGAGCT
TTAAGGAATTTAGTGCTAATAACATTAGGGACACTTTCAGAGTCATCTTGCAGATGGGCGTTGTGCTTATGTTTGGTGGTCAAATGCCTGTAATC
AAGGTGGGTAGAATGGCAGGTCAATTTGCAAAGCCAAGATCTGATCCATTTGAAGAGAAGGATGGCGTGAAGCTGCCAAGTTACAGGGGAGACAA
TGTGAATGGCGATACTTTTGATGAGATATCAAGAATTCCTGACCCCCATAGGATGATTAGGGCCTATACTCAGTCTGTAGCTACATTGAACCTCC
TCAGGNCATTTGCTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541015] SGN-U566919 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341890 [Download][View] Facility Assigned ID: TUS61J10_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5