EST details — SGN-E541087

Search information 
Request: 541087Match: SGN-E541087
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190934Clone name: TUS-61-L4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81874 [cLET-18-K7] Trace: SGN-T107100 EST: SGN-E293275 Direction: 5' Facility: TIGR
Clone: SGN-C190934 [TUS-61-L4] Trace: SGN-T349366 EST: SGN-E548491 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541087Length: 235 bp (724 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E541087 [] (trimmed) GTTGCAGACTCGCGCCATTGCTGCTAACTGACTCTACGGTGTAATCTCATAAATGAGAATTTGATCTGAAAAACCACAAGGAATTGTCGCTTTAT
TATGTGTGGATGTTAGCNTTTTGCTCGTCGAAAATCTCTAAGAGCTTTCCATCTGGAGGAAATATAGTTCTTAATACAGACTCATGCAAAGACTA
AGCATTCTTGATTGGCAGTGTAACTTGAGTTTTTCGATGCATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541087] SGN-U576438 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T341962 [Download][View] Facility Assigned ID: TUS61L04_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0158 Quality Trim Threshold: 14.5