EST details — SGN-E541087
| Search information |
| Request: 541087 | Match: SGN-E541087 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C190934 | Clone name: TUS-61-L4 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C81874 [cLET-18-K7] | Trace: SGN-T107100 | EST: SGN-E293275 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C190934 [TUS-61-L4] | Trace: SGN-T349366 | EST: SGN-E548491 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E541087 | Length: 235 bp (724 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E541087 [] (trimmed)
GTTGCAGACTCGCGCCATTGCTGCTAACTGACTCTACGGTGTAATCTCATAAATGAGAATTTGATCTGAAAAACCACAAGGAATTGTCGCTTTAT
TATGTGTGGATGTTAGCNTTTTGCTCGTCGAAAATCTCTAAGAGCTTTCCATCTGGAGGAAATATAGTTCTTAATACAGACTCATGCAAAGACTA
AGCATTCTTGATTGGCAGTGTAACTTGAGTTTTTCGATGCATAAA
TATGTGTGGATGTTAGCNTTTTGCTCGTCGAAAATCTCTAAGAGCTTTCCATCTGGAGGAAATATAGTTCTTAATACAGACTCATGCAAAGACTA
AGCATTCTTGATTGGCAGTGTAACTTGAGTTTTTCGATGCATAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E541087] | SGN-U576438 | Tomato 200607 | Build 2 | 13 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T341962 [Download][View] | Facility Assigned ID: TUS61L04_Q1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.970 | Expected Error Rate: 0.0158 | Quality Trim Threshold: 14.5 |
Working
