EST details — SGN-E541144

Search information 
Request: 541144Match: SGN-E541144
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190967Clone name: TUS-61-M13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82648 [cLET-20-L9] Trace: SGN-T107594 EST: SGN-E295180 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541144Length: 494 bp (897 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E541144 [] (trimmed) GACAAAAGGGAATATCTTGCTTGTGTTCAACTCTCTGTAGATTTCCAGTAGATTATCCACAGTGGTTGGTCAGCCAAACCCATGGCTATGGCTGC
TTATTCAGTGCTCGCAAACCACTACAAGCAGTTGCCACAAGTACTGTCCTTGTCTATGTTTCTCAGGAAGGACTGAAATACGTTACTGCTACGGA
GTTGCGGAAGCCAATAACTGCTGCGATACTGGCGGCAGCTGCAGCATGTGCTGTGATTGTAGCAGTAAATGGGGCGGAGGCGTTGGCGGTGCCGG
CGCAGATTGAAACGCAACAGGAGGTACTTGGTGAGACATTTTCGAATGTACCGCAAACTTTATCCCGCGATTGTGTTTATGGGCAGAATAATTAG
CAAGAAGGCCAGGATTCAAAGACCTAATTCAAGGCAAGCAGAGACTTGCACGGGCAAATGAGTCAATACTTGTATTCGAGTTGGCAATGGATCTC
CTGGTGAAGGTCCTCTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541144] SGN-U564325 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342019 [Download][View] Facility Assigned ID: TUS61M13_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0301 Quality Trim Threshold: 12.5