EST details — SGN-E541154

Search information 
Request: 541154Match: SGN-E541154
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190973Clone name: TUS-61-M19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82695 [cLET-20-P14] Trace: SGN-T107635 EST: SGN-E295221 Direction: 5' Facility: TIGR
Clone: SGN-C190973 [TUS-61-M19] Trace: SGN-T342026 EST: SGN-E541151 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541154Length: 807 bp (932 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E541154 [] (trimmed) GGGGCATGGATGGCTAAGACCTGCAATAGGAGTGGTGGAACTGTCTCAGAGTATTGTTCAAGCAGTACCTCTCAGCGCAAGGAAAGCAGCAGGTG
GATCCAGTGAAGGGTATGCACCATTTTTGCAGCTGCCACACTTTAGCGAGGCTGTCGTTAAAAAGATAGCAAGAAAGAAAGTTCGTACATTTCAA
GACTTCCGTGACATGACCCCGGATGAACGTGCTGATCTGCTGACTCAAGTTGCTGGGTTCTCCAATGGTGAATCCCACGATGTGGAGATGGTTCT
TGAAATGATGCCTTCAGTGACAATTGATATCACATGTGAGACTGAAGGTGAGGAGGGAATTCAAGAGGGTGACATCGTTACCATGCATGCTTGGG
TCACTCTTAACCGTGGTAGTGGCTTGATACGCGCCCTTCCACATTGTCCATATTTTCCTTTTGACAAAGAGGAGAATTTCTGGCTGATGCTTGCG
GACTCCTTTTCGAATGATGTGTGGCTCTCTCAGAAGGTTAGTTTCATGGATGAAGCTACATCGATAATTGCTGTATCAAAAACAATTCAGGAGTC
AAAGGAAGGGTCTGGTGCAAGTGCAAGGGAAATAAATGTTGCTGTTAAAGAAGCAATTGAGAAAGTGAAAAATGGTTCAAGACTGGTAATGGGGA
AGTTCCAAGCTCCAGCTGAAGGGAACTACAACTTGAGCTCTTTCTGCTTATGTGACTCTTGGATTGGTTGTGATGCAAAGTCGAATATAAANGTA
AAGGTTATGAAACGTAGCAGAGCTGGAACCAGAGGTGGTTTCGCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541154] SGN-U563522 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342029 [Download][View] Facility Assigned ID: TUS61M19_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5