EST details — SGN-E541216

Search information 
Request: 541216Match: SGN-E541216
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191009Clone name: TUS-61-O7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C83155 [cLET-23-I24] Trace: SGN-T108220 EST: SGN-E295495 Direction: 5' Facility: TIGR
Clone: SGN-C191009 [TUS-61-O7] Trace: SGN-T342088 EST: SGN-E541213 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541216Length: 748 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E541216 [] (trimmed) CGAGTGCGAGCTGTGCTACTCCTTACTCCAAATCTCCGTCTTCTCTCTCACGCTCTTTGTCTCTGCAATACCGCGAGCTCTGTAACTTGCCATAC
AAGTGTAAGCAGCACCAGAATGTTCGAATCGGTCTCTCGGTTGAGAACGATAAGGGCTTTGGAACATGGAAAACCTCTTCTCCTTCGTCTCTGCG
TGTTTTCTGTATCCGCGATACCCAAGCTGCAGCTGTCACTGCTAAGTCATGGGATAAATTGATATTAGGCAGTGATACTCCTGTTCTTGTTGAAT
TTCATGCCACTTGGTGTGGCCCCTGCCAGATGGTTCACCGGGTAATTGATGAGATTGCAGGTGAGTATTCAGGGAGACTTAAATGCTATGTACTG
GACGCAGATCGTGAACCAAAAGTTGCTGAGAACTATGATATCAAGGCTGTCCCTGTGGTGTTACTGTTCAAGAATGGGGAGAAATTTGAGTCCGT
TATCGGAACAATGTCCAAGGAGTTCTATGTGGCTGCCATTGAAAGACTTCTATCTTCATAGATGTCATGGTAGCATGCATATGCACAAATTGGAT
AACTTGCTACTTCTACTTAAAAATTATCTTCCCCGGTAGTACCTTGTAATTGCATTTTCCTTTTCTATGAATCATCCGCTCGTTTTCCTCAACAT
TGAGAGCACTTCCTGCTTCTTTCTTCACAATGAAATTTGTATAGGGTCGGTGGACTTGTGAATAGTGACAGCATTACTTAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541216] SGN-U564796 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342091 [Download][View] Facility Assigned ID: TUS61O07_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0030 Quality Trim Threshold: 12.5