EST details — SGN-E541228

Search information 
Request: 541228Match: SGN-E541228
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191016Clone name: TUS-61-O14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C83265 [cLET-23-P15] Trace: SGN-T108145 EST: SGN-E295420 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541228Length: 762 bp (885 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E541228 [] (trimmed) GTAAAAAAAAATGGCTCAATTGTTGTCACCTGTTTGTACAGATTCACTAAAATTACAGAACACAGTTCAGTGTTTCTATACAAGAAGTAAAGTTC
CAATTTTGGGTAATAATTTTAGCTCAATGGGTGTTTTTGGAAAGAAGAGAGGAGGATTAGGGAGGATTAAAGTTGCTTATCAAGATTCTGCTGCT
GCATCTGAGGAAATTGCTGATGATTTTTATGCTGTTTTGGGTTTGCTTCCTGATGCTACACCTGCTCAAATAAAGAAGGCATACTATAGTTGCAT
GAAAGCTTGCCATCCAGATTTGAGTGGTGATGATCCCGAGACCACAAATTTTTGCATGTTTATCAATGAGGTCTATGAGATTCTTAGTGATCCAG
TGCAAAGGAGAGTTTATGATGAGATCCATGGGTACACAGCCACAGCAATTAACCCTTTCCTGAGCGATTCATCGCCGAAAGATCATGTATTTGTT
GACGAGTTTAGCTGCATAGGCTGCAAAAATTGTGCCAATGTTTGCTCAAAAGTGTTTGGGATTGAGGAAGACTTTGGAAGAGCTAGAGTTTACGA
TCAATGTGGACACCCTGATTTAATTCAACAAGCTATAGATAGCTGCCCAGTGGATTGCATACATTGGACTTCTGCTGCACAGCTGTCTTTGCTTG
AGGATGAAATGCGAAGAATAGAAAGAGTAAACGTTGCCTTGATGCTATCANGAATGGGCAGTGGAGCCATGGATGTATTCAGAATGGCGAGCACG
CG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541228] SGN-U566991 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342103 [Download][View] Facility Assigned ID: TUS61O14_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5