EST details — SGN-E541303

Search information 
Request: 541303Match: SGN-E541303
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191060Clone name: TUS-62-A10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C83708 [cLET-25-M23] Trace: SGN-T108354 EST: SGN-E295629 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541303Length: 685 bp (894 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E541303 [] (trimmed) AAGTTGAAATTTTTACTTTCGATTTTGCCGGTATGTCCATGTTCTAACTTTCACATCAAATATGGGAATGTCATGAAAGCTGTACAAGCCATGTC
AAACTAACTCTACTGTCTTCACATTCTTGTGCATTGATCTAATGACTGTTGTAACTTGTTCAATCTGATCTTCACTTGAACAAGACGAAAGGAGC
ACTTTGGCTGTTCCGCCATCTGGATAGCAACCTTCATCGATCATTTCCTCGAAGATTTCTAAGCATCTTTGGTACTGTTTCTTTTTGGAGTATGC
TCCAAGACGGGAAGTCCATGTAACCACATCTGGCTGCAGGTTCTTAGAAGGAAGTGATTGGAAAACTTCTTCCATTTTTACGATAAATCCTGAAC
GTCCATATGCATTGATCAAGATATTGTAGGTGCTGATATCGGCTACGTATGGTCCAGCTTCTATGACAGTCAAGAGTTCTTCCATTTTAGCAAAC
TGGCCAAGACGACCATACAAGTTGAGCATGCTGTTAAGAAGAAAGGTATCTAGTTTCACTCCTGATTTCTGCATCTGATTCACGATTTCTTCACA
TTTTGACACGTTACTGTTTCTAGAGTAGGCTGATATGAGTAACATGTAGGATTTCATCGTAGGAGCTATCCCCAGCCGCGTCATCTCATCAAACA
CAGTTTGTGCATCTTCATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541303] SGN-U584496 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342178 [Download][View] Facility Assigned ID: TUS62A10_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5