Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E541323

Search information 
Request: 541323Match: SGN-E541323
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191073Clone name: TUS-62-A23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C83830 [cLET-26-E3] Trace: SGN-T108936 EST: SGN-E296884 Direction: 5' Facility: TIGR
Clone: SGN-C191073 [TUS-62-A23] Trace: SGN-T342201 EST: SGN-E541326 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541323Length: 825 bp (894 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E541323 [] (trimmed) CCTTTAAAGATCTTGAATAATTTACAGATTCATCAGAAACAAGTACAAATATTATAATTTACTCCTTCTTCATGCACTAATACACTTTTNTGGGT
CAAGAAGATTTTTTTTCTATTGGATTCACAGCTCTGAAGACATGCTGCAGAACAAAAACCTTTTCTTGACATTTCTACAGTTCTTAGTTATAGTA
TACATAATCATCTCAAGAGCCAAAACCTGACATGAAAGTTTTTGATTGATAACAACTTTGTGATTGTCAATAGCAGAAAGAAAGGTTCCCTCGAT
AATAAAAGCAGGATCGGTTACATAACCTGCCTCAGAGAGTAGTTGCCTCTTTTGTATCTACAGGTTCCTTAAATTTTGCCTTTTCACTGAGCTCT
TGAAATGCATGTAGAAGATTCTGAAGTCTTGCAACAAACTCAATCAACAGGGACGTAAATGTTGCCAGTGATAATGTACTAGCACTTTCAAAAGT
CCGTACTTCACGTTCATTTAAAATCACATCTCCAATAAGTGAAAGCCGTGAAGGCCACATTGTCTGCTGCGCGAATACATCTGCTGAGGAACCCC
ATTGTGAAGTAGAAAAGTTGACACTTACATTTGGATTAAGAGTATCCATGTGTTTCAATGTGTGAGCAGACCTTAGATGGAGAGTTGCTTCACTA
AGGGAGTTAATTACCATTGGTTTAGGTTCATTGTCCTTAAGCTCTTGTAGGCGTTCAGGATCTTCAAACTTCTTAGGTCTTTTTGAACTTTCCCA
ATTCTCTGCATTAACCAAAGATAAGATTTTTGGTTCAATCACAATTGGAGATCCTCAGCAGCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541323] SGN-U580360 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342198 [Download][View] Facility Assigned ID: TUS62A23_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5