EST details — SGN-E541421

Search information 
Request: 541421Match: SGN-E541421
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191130Clone name: TUS-62-D8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C84450 [cLET-28-N20] Trace: SGN-T109533 EST: SGN-E297739 Direction: 5' Facility: TIGR
Clone: SGN-C191130 [TUS-62-D8] Trace: SGN-T342299 EST: SGN-E541424 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541421Length: 496 bp (890 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E541421 [] (trimmed) GCCCTTGAAATGTCTTCATATATAGATATATATATATATATATATATTAGAGTAAAAGCAAATTGCACCCGGGTGCAAACCTAAATGTACCAAAA
AAGAAGAAACTTCTCTTTCTTTGTATACACATCATAATCATATATACAATAACAACAATTATGGCTGCTCTTTCTCAGCTCTTAGCTCATATCTA
CACCATGACTACTAGTCTTCGTCACCATTCTCATACTCGAACTCGTAATCTTAGTACGTTCCATAACCGACACAATCTCAGATTCCGGCCGCGGC
CGCCCCATCACAACCAAGCAATACCTCAAACTCATCGACGAAAAAAACCCGGTCAGCCGGTTCAAAACCCCCTCAATCAACCCGGCCGGTTTTTC
CGATACCTGTGCCGTTTGTTTATCGGCATTTGAAGACGGCGAACAAGTACGGAAGCTGAAATGCAAGCATATTTTTCACAAGGATTGTTTGGACA
CGTGGCTCCAACAAGATTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541421] SGN-U585473 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342296 [Download][View] Facility Assigned ID: TUS62D08_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0014 Quality Trim Threshold: 12.5