EST details — SGN-E541767

Search information 
Request: 541767Match: SGN-E541767
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191330Clone name: TUS-62-L16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90066 [cLEW-1-I20] Trace: SGN-T112095 EST: SGN-E299865 Direction: 5' Facility: TIGR
Clone: SGN-C191330 [TUS-62-L16] Trace: SGN-T349478 EST: SGN-E548603 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541767Length: 806 bp (868 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E541767 [] (trimmed) TTACAGAAAGATGAAACAAGAAATTTATGGTGGTACCAATAACAAATGGATAATTACAGCACAACAACAAAGAAGTCAAAAGTGTACATTGTTTC
AAGCTAGAAATAGCTTCATTTTGCTATTATTACTTCTTATTAAACAACATAATCGATAGATAGACAGGAAACAAACTCAAGCATTTTATCACACA
GTAAAAATAAAAACGAATATCAAAACTAAGGAACAACTTTGTAAGCTTTCACCTTATCAATCCAGGAAATGAAGGCTTTTTGTGAGTTCCGGAAT
CCCAAGAAACCGTGCTCCTTGCTCTTGTTCATAGTATCCAAAGCGCAATCTCCAGAAAGGATAAGATCAACAAACCACCAAACTCCAACCTCCTC
CAATTTAGTAGGCACCAATCCATTCTCCTTCACAATCTCATCCCAAACCGCGCCTTTGTCTTTCATCATCTCTACCAATGTGCATCTCTTCCCTT
CATCAAACTCCGCAGCTTCCAGTCCAAATTGCTCACCCAAAACCTTCCAGAAATGCTTCCACTTGAAAACATCCCCATTGCTCACATTAAACGCC
TCATTCTTGGCATAAGGATCCACTGCAGCCCATATCTGATGCTCGGCAATCAAATCCGCATCAGAGCAATCCGAGTATCCATCCCACGCTCCTTT
AACACCAGGAAACTTCAATGGCAACCCTTCATGTTTACATATAGCTGCATAAACACAGAGTGTTCCAACAATATTCATCAAACTATAAGGAGAAA
ACCCAAATATGGTCCCTGGCCGATGAAACTGACACGTCAACCCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541767] SGN-U572979 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342642 [Download][View] Facility Assigned ID: TUS62L16_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5