Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E541961

Search information 
Request: 541961Match: SGN-E541961
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191443Clone name: TUS-63-A9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U576274 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C91818 [cLEW-8-J19] Trace: SGN-T112568 EST: SGN-E300963 Direction: 5' Facility: TIGR
Clone: SGN-C191443 [TUS-63-A9] Trace: SGN-T342834 EST: SGN-E541959 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541961Length: 704 bp (896 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E541961 [] (trimmed) GGAAAGGTGGAGCTGGTGTTGTGTACCGAGGGTCTATGTCAAATGGCATCGACGTTGCAATAAAGAAACTTGTAGGCCGAGGAACCGGACACCAT
GATCACGGATTCTCAGCTGAAATCCAAACACTAGGAAGGATCCGGCACAGAAACATCGTACGATTACTGGGATATGTCTCAAACAAAGACACAAA
CTTGTTGTTGTACGAATACATGTCAAATGGGAGCTTAGGTGAAATGTTACATGGTGCCAAAGGGGCACATTTGAAATGGGAGACAAGGTACCGTA
TTGCTGTGGAAGCTGCAAAAGGATTGTGTTATTTGCACCATGATTGTTCACCTTCGATTATTCACAGAGATGTCAAGTCCAATAATATTCTGCTG
GATTCCGATTACGAAGCGCATGTTGCTGATTTCGGCCTCGCCAAATTCTTGCAGGATGCTGGTGCATCAGAGTGCATGTCCTCTATTGCTGGCTC
ATATGGTTACATTGCTCCAGAGTATGCATACACATTGAAAGTTGACCAAAAGAGTGATGTATACAGTTTTGGAGTTGTACTGTTGGAACTTATCA
CAGGTCACAAGCCAGTAGGTGAATTCGGGGACGGTGTAGATATAGTGAGATGGGTGAATAAAACAATGTCCGAATTATCTCAACCGTCTGATGCA
GCCTCAGTTTTAGCAGTCGTTGACTCGAGGCTACATAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541961] SGN-U576274 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342836 [Download][View] Facility Assigned ID: TUS63A09_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5