Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E541966

Search information 
Request: 541966Match: SGN-E541966
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191447Clone name: TUS-63-A13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U576274 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C91845 [cLEW-8-K6] Trace: SGN-T112427 EST: SGN-E300822 Direction: 5' Facility: TIGR
Clone: SGN-C191447 [TUS-63-A13] Trace: SGN-T342843 EST: SGN-E541968 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541966Length: 639 bp (901 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E541966 [] (trimmed) CATATAATGAAAAATTACATAGGCCCATGTTATTAAATGCAATATTTGAAATTTATTTCCTGAGGCCACATATTCATACTCAATACCCATAATAA
AGTAATTAAAGGAGTTCTTTTCCTTCTTTTTTTTTTCATGCCCCTTTTATACAACAACTTCAAAAATATAAAGACAAGTCTCCCATTGCACAATT
TTTTTTGTTTTCCATACCCGAATAGAGTCATGAGACTCGTGCTCCCGGCCTCAAACTTGACGAGTTTTCAACTATACACTTGATATCCGCGCAAT
TTCAAAGGGCACGGAGAGTAGTAGTAGTGTTAGTAGACTGAGGAGGAGGATTTGTAAGCATGTGAACCACTTCCCTCATGCTAGGCCTAGCACAA
CTCTCTTCTTCAACACACATCATAGCAATCTTGAACAAATTGACAACACTTGCAAGAGGGTAACTATGTAGCCTCGAGTCAACGACTGCTAAAAC
TGAGGCTGCATCAGACGGTTGAGATAATTCGGACATTGTTTTATTCACCCATCTCACTATATCTACACCGTCCCCGAATTCACCTACTGGCTTGT
GACCTGTGATAAGTTCCAACAGTACAACTCCAAAACTGTATACATCACTCTTTTTGGTCAACTTTCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541966] SGN-U576274 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342841 [Download][View] Facility Assigned ID: TUS63A13_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5