Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E542166

Search information 
Request: 542166Match: SGN-E542166
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191562Clone name: TUS-63-F8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C89103 [cLEW-11-L15] Trace: SGN-T112853 EST: SGN-E300013 Direction: 5' Facility: TIGR
Clone: SGN-C191562 [TUS-63-F8] Trace: SGN-T343038 EST: SGN-E542163 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542166Length: 760 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E542166 [] (trimmed) GAACGTATTGAGAGACCACCAGTAATGGGGGCGTACAGATCGGACGACGACTACGATTATTTGTTCAAGGTGGTGTTGATCGGCGATTCCGGCGT
CGGGAAATCTAATCTTCTATCCAGATTTACACGTAGCGAGTTCAGTTTGGAGTCAAAGTCAACGATCGGCGTTGAATTCGCTACTCGTAGCATTC
GTGTTGATGATAAGGTTGTCAAGGCTCAGATTTGGGATACTGCCGGTCAGGAACGATATCGCGCAATCACGAGTGCCTACTATCGAGGAGCTGTT
GGAGCATTGCTTGTCTATGATGTCACCCGTCATGTAACTTTTGAGAATGTAGAGAGATGGTTAAAAGAGCTCCGAGATCACACTGACTCTAGCAT
TGTCATAATGCTGGTGGGTAACAAGGCAGATTTGCGTCATCTGCGTGCTGTTTCTACTGAGGATGCCCAGGCATTTGCAGAGAAGGAAAGTACAT
TTTTCATGGAAACATCCGCTTTGGAGTCCATGAACGTTGAAAGTGCCTTCACAGAAGTGCTCACTCAAATACACCGCGTTGTTAGCAGGAAAGCT
CTTGAAGTAGGAGATGACCCGGCAGCAGTTCCCAAGGGGCAGACGATAAATGTTGGAGGCAAGGATGATGTTTCTGAAGTAAAGAAAGCTGGGTG
CTGTTCTGCTTAGAACAAAGAGTAATCTACACCGCGGGAAGAGATTCTTTTTTGTTTGAGCTGAATTTCACATGACATTTGTACGTCAACCTCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542166] SGN-U577600 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343041 [Download][View] Facility Assigned ID: TUS63F08_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5