Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E542384

Search information 
Request: 542384Match: SGN-E542384
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191689Clone name: TUS-63-K15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C89686 [cLEW-19-B9] Trace: SGN-T113672 EST: SGN-E302248 Direction: 5' Facility: TIGR
Clone: SGN-C191689 [TUS-63-K15] Trace: SGN-T343256 EST: SGN-E542381 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542384Length: 766 bp (888 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E542384 [] (trimmed) GCTGGATTGATCCATTTTCAATATGAAGAGGTAGCAAATCAAATGAAGTTTCCCTTTCATTGAACAATACAATTCTCACATTCCTTTCATGCATA
TCATATAGTGGCTAATGAGCTGCTTCCTCTAAAGCGGAACCGGCTGATTTTGTCTAATGCTCTACAAAAGTGGTCAAAGGGAGAGGGAAGAAGTG
AAGGACTGCTGTAACTAGGATCTTGTTTTTGCATTTTTGTCAGCCAGATCAGTGAAAACATAATGAAGCTCCAGTCTTTACTGGCAGCTATTGTT
TTTCTTATTTCGCTGCTATCAGTATTTCTTAATGTTATAGCTGATCTTGATTCCGATAGACAGGCGCTACTCGACTTTGCAGAATCTGTCCCTCA
TATCCGAAAACTCAACTGGAATTTGGCTCTCCCTATTTGCAAATCTTGGGCTGGTATAGCTTGTAACGAAGATGGAACGAGAGTCATTGCAATCC
ATCTCCCTGCTGTAGGACTTTTTGGTCCTATCCCAGCTAATAGTATAGGCAAGCTAGATGCTCTTAAGGTCCTTAGTCTAAGAGCCAATTATCTT
AATGGAAGTGTTCCTTCTGATCTCCTTTCGATCCCGTCTCTCCAATCTGTCTACCTTCAACATAATAGCTTCTCTGGTGATATTCCTGTTTCTTT
ATCTCCTCGTATTGGTGTACTAGATCTCTCCTTTAATTCATTTACTGGAGAAATTCCCCCCACAATCAAGAACTTGACGCGATTATCTGTGNTTG
ACCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542384] SGN-U563473 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343259 [Download][View] Facility Assigned ID: TUS63K15_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5