Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E542501

Search information 
Request: 542501Match: SGN-E542501
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191759Clone name: TUS-63-N13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90232 [cLEW-20-G15] Trace: SGN-T113849 EST: SGN-E299588 Direction: 5' Facility: TIGR
Clone: SGN-C191759 [TUS-63-N13] Trace: SGN-T343379 EST: SGN-E542504 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542501Length: 822 bp (884 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E542501 [] (trimmed) ATGAATAAGCAAGCTATAGAAAAAGCTGAAAGAATTACTCCAACATGCTCAATCCTCGAGTAGAAGAGTTACATATCTTAGGCTTTCAATAGTTC
AGGCTGCTAACCTACAATTTTTTAATAATTAGAAATCATTTCTCATTTAATAGCTGCATCAGGGACTAAACTATCCATGTAAGATATGACGTAGT
CAAATTGTGGTTCTCTACCCGTATAGAGATGTAAGAAGTGAAAAACAATTATTGAAACCAGAAGGTGGTAGGTTAGCTCAGCTGATTTTCGTCAT
TTACTCTATCAGTCGAAGGATTGGTCACAAATAGATTTAGTCCTCGTGTCCGTCCTGGGGCCCCTCCTTTAACCAAAGACAAGTCCAGAACATAC
ATGCTATCGGATGCCTTTTCATATTCTCCAGCACCACAGTTAATTAAAATCTTCTGATCAATCTTCGAGACTAAATGTTCAACAGGCAAGTCGAC
TAATTCTGAATATGTTTTATGAGCAGTCTTCACACCTTCAGTGAGACCCAAGATGTTCTTAAGATTCTCATAACAACTTTCTAGGTCATCGTTCA
CCAAAATATGATCAAAGAGACCGGATGAGTTTCCTTGTTCGAGTTCCGCCCTAGCATTTCGGAGACGCTTTTGGATTTGCTCTTCAGTCTCAGTT
GCTCTTGCACGAAGGCGCTTCTCAAGTTCTTCAAATGATGGTGGAGATATAAAAATGAAAATAGCTTCAAGAGAGCTAGCTCTCACAGACCTTGC
ACCTTGGACATCAATATCAAGGATGCATCGCTTTGCAGCATCAGCAACCACCTCAACTGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542501] SGN-U568369 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343376 [Download][View] Facility Assigned ID: TUS63N13_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5