Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E542502

Search information 
Request: 542502Match: SGN-E542502
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191758Clone name: TUS-63-N12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90242 [cLEW-20-G4] Trace: SGN-T113814 EST: SGN-E299553 Direction: 5' Facility: TIGR
Clone: SGN-C191758 [TUS-63-N12] Trace: SGN-T343375 EST: SGN-E542500 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542502Length: 804 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E542502 [] (trimmed) TATCATGGTGAAGTTTGTGACAATTTCATCTAAAAGCTTAAACTTTTATTTGTTTAATTATGCCTTCAACAATAAAAATATACGTATTATGTATG
TATGTATCTTGTCCCATGTGACAAAGACTTATGCTGGTATAGAGGAACTGGAAAAACCAATATAAACATAGTTTGCTTCTTCAACATATGGAACT
TTCATGTTCTTCCTCTGCAAGTGCCATGTTTGCAAGAAAACTACGAGGGAAAATGCTGAAGAGCTCATGCAATCATTTTAAGTTGGTTTGCATCT
TCCTCGCTTTTATGATAGAAAGATGCTTCAGGAATGGTTGCCATCCTTCCCTATCAGCCTGAAAAACTCCAACAGTTCTTTTCACTTAAAATTTT
CTTTATCCCATCATCTTTGCAGATGCCTCTGTTGACAGGGATAAGGACTCTGAAAGTAGCGTCCCTTCCATTCCTCCAAGTTCTATTCTGAGTAT
TGATCTTGAACTAGTTTCTTTCAAGCCGGTAATAAATGTGACTTGTGATTTGGGAGTTCTAAAGAAGATTTTAAAAGAGGGAGAAGGCACTCTTA
CTGCAGATGAAGGTGCTGCTGTGACTATTAGGTATACAGCTAAGCTTGTGGACGGCACTTTGCTTGAGAAAGAGGCTTTGATGGAGAGAACGCGC
TGAAGTTTATAACTGATGAAGAACAAGTCGTTGCTGGACTGGACCAAGCTGTTACTACAATGAAGAAGGGAGAAACACGCATAGTGACAGTTAAA
CCTGACTATGGGTTTGGAATACTGAAGTGAAGCGGGATCTTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542502] SGN-U565131 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343377 [Download][View] Facility Assigned ID: TUS63N12_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5