EST details — SGN-E542674

Search information 
Request: 542674Match: SGN-E542674
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191856Clone name: TUS-64-B14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90636 [cLEW-23-H15] Trace: SGN-T114308 EST: SGN-E301671 Direction: 5' Facility: TIGR
Clone: SGN-C191856 [TUS-64-B14] Trace: SGN-T343550 EST: SGN-E542675 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542674Length: 486 bp (907 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E542674 [] (trimmed) TGTTCCTGAGATTATAGTACAAACTTTNGGAAGTGTGTCCTTGTACATTACATTTGGATTGAATACAACAATTACGTCTTAGCACATCATAACAT
AACTACAATAGCAAAAGCAGCTAATGTTCATCGACCAGCCCAAAATATATAAATATAGATTCTTGTCATACCTTCTTGGCCAGCAACGAGAAGAT
GTTGTCGTTAAGTTCAGTGAGAATATTACATAGTACTCGCCTCTGCTCGACTACCTATTAGTGTTGGCTGCCTTCTTAAGATACTTCTTGTGAAG
CTTCATAGCGCTACTGCAAGCCTTTCTGGCATCCAAGTGTCCAGTAATATTATTCAGGATCTTAACAACTTCGTCCAGTCCTCTAGCTTCTGTTA
GCTTCGCACTCTTGTCCTTCAGGACGCTGGCTACTAGGAAAACAGAAATTGGGAGGGGAGCTTCTGTATCTTTACCTCCACTTCTCATGTTTTCT
CTCTCATATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542674] SGN-U563414 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343549 [Download][View] Facility Assigned ID: TUS64B14_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5