EST details — SGN-E542681

Search information 
Request: 542681Match: SGN-E542681
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191860Clone name: TUS-64-B18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90646 [cLEW-23-I13] Trace: SGN-T114133 EST: SGN-E301496 Direction: 5' Facility: TIGR
Clone: SGN-C191860 [TUS-64-B18] Trace: SGN-T343557 EST: SGN-E542682 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542681Length: 538 bp (916 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E542681 [] (trimmed) TTACAAATATGGAACATTGTTTTGTTCCTGAGATTATAGTACAAACTTTGGAAGTGTGTCCTTGTACATTACATTTGGATTGAATACAACAATTA
CGTCTTAGCACATCATAACATAACTACAATAGCAAAAGCAGCTAATGTTCATCGACCAGCCCAAAATATATAAATATAGATTCTTGTCATACCTT
CTTGGCCAGCAACGAGAAGATGTTGTCGTTAAGTTCAGTGAGAATATTACATAGTACTCGCCTCTGCTCGACTACCTATTAGTGTTGGCTGCCTT
CTTAAGAATACTTCTTGTGAAGCTTCATAACGCTACTGCAAGCCTTTCTGGCATCCAAGTGTCCAGTAATATTATTCAGGATCTTAACAACTTCG
TCCAGTCCTCTAGCTTCTGTTAGCTTCTCACTCTTGTCCTTCAGGACGCTGGCTACTAGGAAAACAGAAATTGGGAGGGGAGCTTCTGTATCTTT
ACCTCCACTTCCCAAGTTTACTCTCTCATATTTCCCATACTGACGTATCGACTTAACTTTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542681] SGN-U563414 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343556 [Download][View] Facility Assigned ID: TUS64B18_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0051 Quality Trim Threshold: 20.5