Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E542729

Search information 
Request: 542729Match: SGN-E542729
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191888Clone name: TUS-64-C22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90765 [cLEW-24-A11] Trace: SGN-T114434 EST: SGN-E301311 Direction: 5' Facility: TIGR
Clone: SGN-C191888 [TUS-64-C22] Trace: SGN-T343605 EST: SGN-E542730 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542729Length: 845 bp (901 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E542729 [] (trimmed) ATGCCAGATTCAGATTTTCTCTCTGTTTCACAATCTGAAGCAGACTCATTCTTCTTTGAGTCGCTTCCTAGTTTTCTTTTGGCACACTGTGTGCG
CTTGGTTCTCTCTCCCAAATGAAGAGAATCTTTTTTCTGAACTTGGGATTGTGGCACATCTCCTATTGGAATTGACACAACCAGCTCATCATCGT
TATTTATCGGGATCTCTTTTCTCTTGGACTGACACAGATGACCATGACTTCCAGTGCTATTATTGTGATTTTCAGACACCAAAGAATGATGGCCA
CTACTATCTGTAAGTTCATGACTTCCAGTCCCTTCCTGGTTTTCTTTTGGCACATTTGTTGCTGGTTGCACATCTTCTGGATTGTCAGGTTTCAT
TATGTTTGTTGTACAAGTATCTTTTAGCTTCTCCCTGTGAATGTCATCCTGCAGCACTGGCTCACAAAATTTAGCCTCGGATGGACCAACTTTTA
CAGGATGACCTGTAAGTTTATGGCTTCCAGTCCCTTCCTGGTTTTCTTTTGGCACATTTGTTGCTGGTTGCACATCTTCTGGATTGACAGGTTTC
ATGATGTTTGTTGTACAAGTATCCTTTAGCTTCTCCCTGTGAATGTGAATGTCATCCTGCAGCACTGGCTCACAAAATTTAGCCTCGGATGGACC
AACTTTTACAGGATGACCTGTAAGTTTATGGCTTCCAGTCTCTTCCTGGTTTTCTTTTGGCACATTTTCTGCTGAGTGCACATCTTCTGGATTGA
CTGGTTTCATGATGTTAGGTAGACAAGTATCCTTTCGCTTCTCCCTGTGAGTGTCATCCTGCCGCGCTAGCTCACAACATTTAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542729] SGN-U576286 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343604 [Download][View] Facility Assigned ID: TUS64C22_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0036 Quality Trim Threshold: 20.5