EST details — SGN-E542816

Search information 
Request: 542816Match: SGN-E542816
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191938Clone name: TUS-64-E24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90990 [cLEW-25-E12] Trace: SGN-T114629 EST: SGN-E301870 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542816Length: 405 bp (973 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E542816 [] (trimmed) AATTCCGCACGAGGCGCCTAATTTTTCTTCTCTAAGTTTCTTAGTGTCTCAAGATGGGTAAAGAGAAGATTCACATCAGCTTCGTGGTCATTGGT
CATGTTGACTCTGGAAAGTCGACTACCACTGGTCACTTGATCTACAAGCTTGGTGGTATTGACAAGCGTGTTATTGAGAGGTTCAAGAAGGAAGC
TGCTGAGATGAACAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAACTTAATGCAGAACGTCAGCGTGGTATCACCATTGATATTGCTTTGT
GGAAGTCCGAGACCACTAAGTACTACTGCACTGTTATTGATGCCCCCATCCACAGGGATTTCATCAAGAACATGATCACTGGAACCTCTCAGGAT
GACTGTGCTGGTCTTATTATTGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542816] SGN-U580418 Tomato 200607 Build 2 320 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343691 [Download][View] Facility Assigned ID: TUS64E24_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0195 Quality Trim Threshold: 14.5