EST details — SGN-E543029

Search information 
Request: 543029Match: SGN-E543029
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192062Clone name: TUS-64-K4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93901 [cLEX-1-C24] Trace: SGN-T115241 EST: SGN-E302658 Direction: 5' Facility: TIGR
Clone: SGN-C192062 [TUS-64-K4] Trace: SGN-T343903 EST: SGN-E543028 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543029Length: 647 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E543029 [] (trimmed) GGGAATGGAAATAGTAAAGTTAATAGGTACTCCTTTTAGTTTTTTCACATATAGAGTTATTTGGGCATTAAAGCTAAAGGGAATAAATTATGAGT
ATATAGATGAAGACATGTCCAAGAAAAGTTCTTTGCTTGTAAAATACAATCCAATTCACAAGAAAGTTCCAGTTCTAATCCATGGTGACAAGATA
ATTTGTGAGTCTATGGTCATCGTTGAATACATCAACGAGACGTGGAAACTGAATCCATTACTTTCAACTGATTCATATGAACGAGCCACATCTCG
ATTTTGGGCTAAATATATCGAAGAAAAGTCGCATAGTTCATGGAATGTATTTTGTTACACTGGAGAAAAGCAACAAAATGCTATAAAGGAGAGCC
TTGAAATGTTCAAAACCATAGAGGAAAATGCTTTGGGAGAAAACAATATATTATTTGGTGGTGAAAATATTGGATTTGTTGACATAGCTTTTGGA
GGTTATTCTCTTTGGATGGAAATTATTGAAGAAATTGTTGGGATTAAGTTACTTAATCCTCACAATTTTCCTCGTATTAACAATTGGATAAAAAA
ATTCAAGAAGTTCAAAACATCAAAGATAATTTACCTAATCGTGATGAGATGTTTGTGTACATGAAAAATGCTAGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543029] SGN-U586601 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T343904 [Download][View] Facility Assigned ID: TUS64K04_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5