EST details — SGN-E543127

Search information 
Request: 543127Match: SGN-E543127
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192119Clone name: TUS-64-M13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94194 [cLEX-2-M17] Trace: SGN-T115411 EST: SGN-E303323 Direction: 5' Facility: TIGR
Clone: SGN-C192119 [TUS-64-M13] Trace: SGN-T344001 EST: SGN-E543126 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543127Length: 672 bp (881 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E543127 [] (trimmed) GAGGAAGGAGTCTCCGACGACTTTATCGTCCAATTGGTATCAGAAATAAAAGCAGAATATTTTCCACCAAAAGTGGATATTGTCATACAAAATGA
GATACCAACAGATTTCTACATTATTGTATCTGGGGCTGTGGATGTTGTAACATACAAGAACGGAATGGAACAATTTTTATCCAAGTTGGGATCTC
AACAAATGTTTGGAGAAATAGGTGTAATATTCAATATCCCTCAACCTTTCACAGTGAGAACTAAAAGGCTTTCTCAAGTTGTTCGTATTAGTCAT
CATCATTTCAAGCAATTGGTACAACCCCTTCATGAAGATGGAAAAATAATTCACACTAATTTTATTCAGCATTTGAAGGGATTGAAAAATGAGGA
GCTAGCTGAGATGCCGCTAATATCAGAATTTCTTGATGATTTAATTAGTGAGGAAGCCTCGATGAATGAGGCCGGAGCTCAAGACCAACAAGAAA
ACGAGTTATCGGCAACTACTTCTTCGTTATCAAAAACACCTTCTACTAGAGTGATAATTCACGGATATCACCCGGATCATAAGCCAAAATCAGGA
GGAAAACTTATACATCTACCTGAATCAATTGAAAATCTTCATAGTATTGCAGAAAGTAAGTTTGGGAGAAGAGAAATACGATTCTCATGGCGGAT
GGTTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543127] SGN-U564485 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344002 [Download][View] Facility Assigned ID: TUS64M13_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5