EST details — SGN-E543160

Search information 
Request: 543160Match: SGN-E543160
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192139Clone name: TUS-64-N9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94320 [cLEX-3-I20] Trace: SGN-T115350 EST: SGN-E302020 Direction: 5' Facility: TIGR
Clone: SGN-C192139 [TUS-64-N9] Trace: SGN-T344036 EST: SGN-E543161 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543160Length: 491 bp (867 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E543160 [] (trimmed) AAATCCTCAGCTTTATAATAATTCAACATACAAAGTGCATAGGACAGGTCAGTAGACTGACTGTTTTAAACAAGTTGAAATTATATACATAGTCT
AAGAAGACTTGATATATCAATACACATACAGAGGACTAATACAAAGAAGGGTTAGATCAATGACATATTTGATCCCTAGGAAACTCGTATGGCAC
TGATTTTACAATAAATAGAAGTTCACATCGTATAATATACAGAAATACAAGAGAATCGAACTCCACAAATAAAATTGAAGATAGATAGGGCTAAA
ATTAGTTACATTTATCTCCCTAGATTTTGTATACCTATACACTAAGGCTACAGAAGGTCAAAATGGGTGTCATACTACATGAAAGATATTTCTTA
TTTGGACTACTTCACAGGACTGCTCTATAGTGGAGATGGCGAAATACAACAATCTGTTTTGGCCAACATAATTAGAAAGTTAACTCCATATTGGA
AAGCCTTACCACATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543160] SGN-U579429 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344035 [Download][View] Facility Assigned ID: TUS64N09_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5