EST details — SGN-E543355

Search information 
Request: 543355Match: SGN-E543355
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192252Clone name: TUS-65-C2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543355Length: 342 bp (897 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E543355 [] (trimmed) GTTGGATTTGGGTTGGCAGCATGAGATGAGAGCAATGGGACCTGATGCTACTTCTTATCGTCCAGGACTTTACTTAACCCAAGCTCAGACAGAAG
CAGTGGAAGCACTCATTCAGGAACTGCCAAAGTTCTGCCTGAAGGCTGTTCCTACTGACTGTAGCGAGTGCCCTATCTGTTTGGAAGAGTTTCGC
ATGGGAAATGAGGATCGTGGTCTGCCTTGTGCTCACAACTTTCACGTGGAATGCATTGATGAATGGCTTCGCCTAAACGTGAAATGCCCTAGATG
CCGCTCTTCTGTCTTTCCAAGTCCTGATCTCAGATGCATTATCCAATATCCGAACCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543355] SGN-U580880 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344230 [Download][View] Facility Assigned ID: TUS65C02_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0152 Quality Trim Threshold: 14.5