Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E543438

Search information 
Request: 543438Match: SGN-E543438
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192300Clone name: TUS-65-E2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95109 [cLEX-8-I18] Trace: SGN-T115994 EST: SGN-E301467 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543438Length: 458 bp (911 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E543438 [] (trimmed) GCTTTCGAGCAATGATTTAGGCAAAATGGCTAGTGGCTTTGGCTACTTGAAATCTTTGGAACATCTTAATCTATTTGGTAATAGTATTCAAGGAG
GGATACCAAGGTCTTTAAGAAATTTAAGTCGTTTACGCTCTCTTGATGCTAGTAACAATAACTTGTTAAGTCAACCGTTTTCTGAGTTGCTTGAT
AACTTAGCTGGGAGTAATCAATCGCTTGAATATCTGTCCTTCGAGGGAAATGCACTCACTGGCTCATTGATTAATCTTACTAGATTTTCATCCTT
GAAGGAATTGAAGCTACGAGAAAACTCGCTGGATGGCATTTTCCATGAAAGCTTTAGACAAATCTCCAGTCTTGAGTATCTTGATTTGTCTAGTA
ACCAAATGACAGGGTCATTACCAGACTTGGAATTTCTTCCATCATTGACAGAGTTGAACTTACGGTCCAATCACTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543438] SGN-U571332 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344313 [Download][View] Facility Assigned ID: TUS65E02_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5