Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E543491

Search information 
Request: 543491Match: SGN-E543491
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192331Clone name: TUS-65-F9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C92133 [cLEX-10-D19] Trace: SGN-T116807 EST: SGN-E305033 Direction: 5' Facility: TIGR
Clone: SGN-C192331 [TUS-65-F9] Trace: SGN-T344365 EST: SGN-E543490 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543491Length: 785 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E543491 [] (trimmed) GTTCTCTTCCGCAGCTTCTCTAGCCTCGCCTCATCCATCCCCTTCCCCCAAACCCCCCCCAAAGCAGAGCAAATCTCTTCTTTCCAACATGGCCG
TCGGCAAGAACAAGAGGATTTCCAAGGGAAAGAAGGGAGGAAAGAAGAAGGCGGCGGATCCCTACGCAAAGAAGGACTGGTATGACATCAAGGCA
CCATCTGTTTTTGAAATTAAGAACGTCGGCAAAACCCTTGTTACCAGGACTCAGGGTACCAAGATTGCTTCAGAGGGTCTAAAACACAGAGTATT
TGAAGTTAGCCTGGCTGATCTTCAGAAGGATGAGGATCAGGCTTTCAGGAAAATCCGTTTGAGAGCAGAAGATGTGCAAGGGAGGAATGTTCTCA
CAAACTTCCATGGAATGGATTTCACAACAGATAAGCTGAGGTCTCTGGTCCGCAAATGGCAGACTTTGATTGAGGCCCATGTTGATGTCAAGACT
ACAGACAGCTATACTCTAAGGATGTTCTGTATTGCTTTTACAAAGAAGCGTCCAAACCAACAGAAGCGTACCTGCTATGCCCAGAGCAGCCAGAT
CCGTCAGATCCGCAGGAAGATGGTTGAGATCATGAGGAACCAAGCCAGTTCCTGTGACTTGAAGGAGTTAGTTGCAAAATTCATCCCCGAATCAA
TTGGCAGGGAGATTGAGAAAGCAACTTCCAGCATCTTCCCCCTACAAAATGTCTATATTCGAAAGGTCAAGATCCTCAAGGCCCCCTAATTTGAC
CTTGGCAAGCTGATGGAGGTTCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543491] SGN-U579808 Tomato 200607 Build 2 82 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344366 [Download][View] Facility Assigned ID: TUS65F09_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5