Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E543553

Search information 
Request: 543553Match: SGN-E543553
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192367Clone name: TUS-65-G21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C92314 [cLEX-10-N16] Trace: SGN-T116766 EST: SGN-E304992 Direction: 5' Facility: TIGR
Clone: SGN-C192367 [TUS-65-G21] Trace: SGN-T344427 EST: SGN-E543552 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543553Length: 625 bp (893 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E543553 [] (trimmed) GTTTTCTCTCAAAGCAAAAATGGGGTTGTTTAACATGTCATTGTTACTTATGACTTGTCTCATGGTATTAGCCATATTTCACTCTTGTGATGCTC
AAAATTCACCCCAAGACTATCTTGAGGTTCACAACGACGCCCGTGCCCAAGTCGGAGTCGGGCCAATGTCTTGGGATGCCGACTTGGAATCCCGA
GCACAAAGCTATGCCAACTCAAGAGCGGGTGATTGTAACTTGATTCATTCTGGTTCAGGGGAGAATCTTGCCAAGGGTGGTGGTGACTTCACGGG
GAGGGCCGCTGTGGAATTGTGGGTGTCGGAAAAGCCAAACTACAACTACGATACGAATGAATGTGTTAGCGGAAAAATGTGCGGACATTATACTC
AAGTAGTCTGGCGTGACTCAGTTCGACTAGGTTGTGGTCGGGCTCTTTGCAACGACGGGTGGTGGTTTATTTCTTGCAACTATGATCCTGTAGGC
AATTGGGTCGGACAACGTCCTTACTAAAATGTTTTTTTTTTTTTGTATGATGTGTAAGGGATCAAATAATTATTATTATTTCCCTTTGATGTTTG
CTAGTATGAATAATTCCACATACCATATGTTCATGGTATAGTGGGGCTTAAGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543553] SGN-U578064 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344428 [Download][View] Facility Assigned ID: TUS65G21_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 1.016 Expected Error Rate: 1.0000 Quality Trim Threshold: 14.5