EST details — SGN-E543671

Search information 
Request: 543671Match: SGN-E543671
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192436Clone name: TUS-65-J18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C92638 [cLEX-11-P23] Trace: SGN-T116951 EST: SGN-E304595 Direction: 5' Facility: TIGR
Clone: SGN-C192436 [TUS-65-J18] Trace: SGN-T344545 EST: SGN-E543670 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543671Length: 683 bp (909 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E543671 [] (trimmed) GAGCAAGTGAAATTGTTTGGAGCTTTTCCAAGTCCCTTTAGTCATAGGATCATTTGGGCTTTGAAACACAAGAATATTAGTTATGAATACATAGA
AGAAGATCTTTCTAACAAAAGCCAACATCTTTTGACATATAACCCTATCTATAAGATGATCCCAATTCTTGTACATAATGAAAAACCAATAGTTG
AATCAACAATCATTCTTGAATACATTGAAGAAACATGGCCCCAAAATCCTTTGTTCCCAAAGGATCCTTATGAAAAGGCTAAGGCTAGATTCTGG
ATCAAGTTCGGAGAAGATAAGAACTCAGAATTTCATCAAATATTTCACAAGATTGGAGAAGAGCAAGTCAAGGCAACTGAAAATGCCAAAAAAAT
CCTAAAAATTATAGAGGAACAAGGTCTTGGAGATAAAAAGTTTTTTAGTGGGGATTCAATTGGTTTAATTGACATAGCTTTTGGGTGGCTTGCTT
TCTGGCTAGAAGTCATACAAGAAGCTGCTGGAGTAAAGGTCTATGAACCAAACAATTTTCCTCATTTACAATCTTGGATTTACAATTTCAAACAA
GTAGCTATCATCAAAGAAAATATCCCAAATCGAAATGCAATGCTAGATTATTTCAAACATCGTAGAGATATGATTGTTGCATTATGATCACTTCA
ATGTTGATGATGGGTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543671] SGN-U567445 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344546 [Download][View] Facility Assigned ID: TUS65J18_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5