EST details — SGN-E543677

Search information 
Request: 543677Match: SGN-E543677
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192440Clone name: TUS-65-J22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C92678 [cLEX-12-C2] Trace: SGN-T117298 EST: SGN-E304433 Direction: 5' Facility: TIGR
Clone: SGN-C192440 [TUS-65-J22] Trace: SGN-T344553 EST: SGN-E543678 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543677Length: 681 bp (929 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E543677 [] (trimmed) GGGCCCCCCCTCGAGTTTTTGTTTTTTTCTTAAATAGAGAGAAAGTTAATATTGTACATGTATTCATTCTGTTCGTAACACCACATAACCAAACT
ACATCTTATTCAATATATATAAACCCATCATCAACATTGAAGTGATCATAATGCAACAATCATATCTCTACGATGTTTGAAATAATCTAGCATTG
CATTTCGATTTGGGATATTTTCTTTGATGATAGCTACTTGTTTGAAATTGTAAATCCAAGATTGTAAATGAGGAAAATTGTTTGGTTCATAGACC
TTTACTCCAGCAGCTTCTTGTATGACTTCTAGCCAGAAAGCAAGCCACCCAAAAGCTATGTCAATTAAACCAATTGAATCCCCACTAAAAAACTT
TTTATCTCCAAGACCTTGTTCCTCTATAATTTTTAGGATTTTTTTGGCATTTTCAGTTGCCTTGACTTGCTCTTCTCCAATCTTGTGAAATATTT
GATGAAATTCTGAGTTCTTATCTTCTCCGAACTTGATCCAGAATCTAGCCTTAGCCTTTTCATAAGGATCCTTTGGGAACAAAGGATTTTGGGGC
CATGTTTCTTCAATGTATTCAAGAATGATTGTTGATTCAACTATTGGTTTTTCATTATGTACAAGAATTGGGATCATCTTATAGATAGGGTTATA
TGTCAAAAGATGTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543677] SGN-U567445 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344552 [Download][View] Facility Assigned ID: TUS65J22_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0087 Quality Trim Threshold: 12.5