EST details — SGN-E543781

Search information 
Request: 543781Match: SGN-E543781
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192500Clone name: TUS-65-M10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93006 [cLEX-13-G23] Trace: SGN-T117549 EST: SGN-E306456 Direction: 5' Facility: TIGR
Clone: SGN-C192500 [TUS-65-M10] Trace: SGN-T344655 EST: SGN-E543780 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543781Length: 476 bp (824 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E543781 [] (trimmed) GATCGTAAACAAGGTTTCAAGACTTTAAAGCTTAAGGTGGGCAAGAATTTGAACGGAGACATTGAAGTGCTTCAATCCATACGTGCAGCACATCC
TGATTGCTTGTTTATCTTAGATGCTAATGAAGGTTACACGGCAAATGAAGCTATTAAAGTCCTGGAAAAGTTGCATGAAATGGATGTCACTCCGG
TGCTATTTGAACAACCTGTTCATAGAGATGATTGGAAAGGTCTTGGTCATGTCAGTCAGATTGCAAAGGACAAATATGGGGTATCTGTTGCTGCC
GATGAAAGTTGTCGAAGTTTGGTTGATGCTAAAAAGATAGTGCAAGAAAGTCTTGCTGATGTCATTAACATTAAGCTTGCCAAAGTTGGGGTGCT
TGGGGGGCTCTGGAAATTATTGACTTGGTGAGGTCCTCGGGCTTAAATCTGATGATCGGGGGTATGGTTGAAACCAGGCTTGCCATGGGCTTTGC
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543781] SGN-U582187 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344656 [Download][View] Facility Assigned ID: TUS65M10_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5