Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E543787

Search information 
Request: 543787Match: SGN-E543787
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192504Clone name: TUS-65-M14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93056 [cLEX-13-I7] Trace: SGN-T117553 EST: SGN-E306460 Direction: 5' Facility: TIGR
Clone: SGN-C192504 [TUS-65-M14] Trace: SGN-T344663 EST: SGN-E543788 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543787Length: 709 bp (964 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E543787 [] (trimmed) TTGAGATTGTCAAAGAGAAGATCAAGCAAGACGTTCTCAACTAACATCAATTTCAACAGACAATAAGACATTTACATATTTGTTTACTCTAAAGA
TTGGATATTCTAGCATTGTGTTCCAATTCTTTGGCACATAAACATTTCAAATTTACCAACGACTAATTCACAAGTACATATGCATAACTATAATT
AGGTTGTGAGTGACAATCCTGAATAGTGAACAAGCTCCGCTACTAATATCATGCAATAGTCTCCCAATGAAGAAAACCACCGTGCCCTCTAGCAT
TTGAGAAGCTGGAATCAGGTCCAGAAGCTTCATAACCCCCAAAAACTGGATCTTCTGCCAACAGAAGGGGTGTGTCTAGGTCAATGAATTTGAAA
CATCCAAGGCCAGCGGCTAGATGACCAGCAAAGCCCATGGCAAGCCTGGTTTCAACCATACCACCGATCATCAGATTTAAGCCCGAGGACCTCAC
CAAGTCAATAATTTCCAGAGCCCCAAGCACCCCAACTTTGGCAAGCTTAATGTTAATGACATCAGCAAGACTTTCTTGCACTATCTTTTTAGCAT
CAACCAAACTTCGACAACTTTCATCGGCAGCAACACATACCCCATATTTGGTCCTTTGCAATCTGACTGACATGACCAAGACCCTTTCCAATCAT
CTCTATGAACAGGTTGTTCAAATAAGACCGGAGTGACATCCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543787] SGN-U582187 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344662 [Download][View] Facility Assigned ID: TUS65M14_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0068 Quality Trim Threshold: 20.5